Touchscreen Learning Deficits and Normal Social Approach Behavior in the Shank3B Model of Phelan–Mcdermid Syndrome and Autism
(Full-text capture 2026-09-21; web artifacts lightly stripped; truncated.)
Nycole A Copping
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
Elizabeth L Berg
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
Gillian M Foley
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
Melanie D Schaffler
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
1, Beth L Onaga
Beth L Onaga
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
Nathalie Buscher
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
Jill L Silverman
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
1,†, Mu Yang
Mu Yang
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
1,*,†
- Author information
- Article notes
- Copyright and License information
1MIND Institute, Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Sacramento, CA 95817, United States
*
Corresponding author. Address: MIND Institute and Department of Psychiatry and Behavioral Sciences, University of California Davis School of Medicine, Room 1002B, Research II Building 96, 4625 2nd Avenue, Sacramento, CA 95817, United States. Tel: +1-916-712-8538. muyang@ucdavis.edu (M. Yang)
†
Co-contributing senior authors.
Issue date 2017 Mar 14.
PMCID: PMC5108683 NIHMSID: NIHMS791938 PMID: 27189882
The publisher’s version of this article is available at Neuroscience
Abstract
SHANK3 is a synaptic scaffolding protein localized in the postsynaptic density and has a crucial role in synaptogenesis and neural physiology. Deletions and point mutations in SHANK3 cause Phelan–McDermid Syndrome (PMS), and have also been implicated in autism spectrum disorder (ASD) and intellectual disabilities, leading to the hypothesis that reduced SHANK3 expression impairs basic brain functions that are important for social communication and cognition. Several mouse models of Shank3 deletions have been generated, varying in the specific domain deleted. Here we report impairments in cognitive function in mice heterozygous for exon 13–16 (coding for the PDZ domain) deletion. The touchscreen pairwise discrimination task was chosen by virtue of its: (a) conceptual and technical similarities to the Cambridge Neuropsychological Test Automated Battery (CANTAB) and NIH Toolbox Cognition Battery used for testing cognitive functions in humans, (b) minimal demand on motor abilities, and (c) capability to measure many aspects of learning and memory and complex cognitive functions, including cognitive flexibility. The similarity between our mouse tasks and human cognitive assays means a high translational validity in future intervention studies using preclinical models. Our study revealed that Shank3B heterozygous mice (+/–) were slower to reach criterion in the pairwise visual discrimination task, and exhibited trends toward making more errors (first trial errors) and more correction errors than wildtype mice (+/+). Open field activity was normal in +/–, ruling out hypo- or hyperactivity as potential confounds in the touchscreen test. Sociability in the three chamber test was also normal in both +/+ and +/–. These results indicate a deficit in discrimination learning in the Shank3B model of PMS and ASD, suggesting that this mouse model is a useful preclinical tool for studying neurobiological mechanisms behind cognitive impairments in PMS and ASD. The current findings are the starting point for our future research in which we will investigate multiple domains of cognition and explore pharmacological interventions.
Keywords: SHANK3, Phelan–McDermid Syndrome, autism, touchscreen, mouse models, associative learning
Introduction
SHANKs are scaffolding proteins enriched in the postsynaptic density. They are crucial for the formation and stabilization of synapses ( Qualmann et al., 2004; Grabrucker et al., 2009). SHANK3 (also referred to as PROSAP2) encodes a structural component of excitatory synapses important for synaptic morphology and functions ( Herbert, 2011; Harony-Nicolas et al., 2015). Consisting of five domains (ankyrin repeats, SH3, PDZ, proline-rich, and SAM) ( Naisbitt et al., 1999; Sheng and Kim, 2000; Bourgeron, 2007; Buxbaum, 2009), SHANK3 can interact with multiple key synaptic components, including glutamate receptor complexes, anchoring proteins, and actin cytoskeleton ( Bockers et al., 2001; Roussignol et al., 2005; Baron et al., 2006; Durand et al., 2008; Bertaso et al., 2010). Heterozygous deletions or point mutations of SHANK3 are thought to be the main cause of Phelan–McDermid Syndrome (PMS, also referred to as 22q13 Deletion Syndrome), a genetic disorder characterized by global developmental delays, delayed or absent speech, moderate to severe intellectual disability, autism, some dysmorphic features, neonatal hypotonia, and seizures ( Bonaglia et al., 2001; Phelan, 2008; Phelan and McDermid, 2012; Harony-Nicolas et al., 2015). Haploinsufficiency of SHANK3 due to deletion or de novo mutations occurs in approximately 1% of autism spectrum disorder (ASD) cases, making SHANK3 abnormalities one of the most common genetic causes of autism ( Durand et al., 2007; Moessner et al., 2007; Buxbaum, 2009; Betancur and Buxbaum, 2013; Boccuto et al., 2013).
In addition to impaired social communication and repetitive behaviors, a hallmark feature of autism is restricted interests, deficits in set shifting and behavioral inflexibility ( Dawson et al., 2002; D’Cruz et al., 2013; de Vries et al., 2015; Miller et al., 2015). A crucial step toward understanding cognitive inflexibility in ASD is to characterize associative learning in this disorder.
Our present study aimed at evaluating associative learning in the Shank3B model of PMS and ASD. Four independent groups have generated mouse models of Shank3 deficiency or ablation ( Bozdagi et al., 2010; Peca et al., 2011; Wang et al., 2011; Kouser et al., 2013), and impaired learning and memory have been reported in all models. The current study employed the PDZ domain deletion model originally generated in the Feng lab ( Peca et al., 2011). This model has both construct validity (reduced expression of Shank3 mRNA and protein) and some face validity (Excessive/injurious repetitive self-grooming and altered sociability) ( Peca et al., 2011). +/+ and +/– were used in the current study, because: (a) heterozygous deletion is translational and analogous to deletions found in clinical populations, (b) excessive/injurious self-grooming and low general locomotor activity in null mutants of this line could confound results of the touchscreen operant learning task. Since no previous studies have evaluated complex learning in any of the deletion models, we chose the automated touchscreen task for its conceptual and technical similarities to the Cambridge Neuropsychological Test Automated Battery (CANTAB), an automated computerized battery of cognitive assays commonly used to test cognitive function in humans. In order to rule out hypo- or hyperactivity as confounds in this cognitive assay, we conducted the open field test to measure general locomotor activity. In a previous study on the Shank3B model, altered sociability was found in null mutants, but no data were reported in heterozygous mutants ( Peca et al., 2011). Given the relevance of heterozygous deletions to the human disease condition, we therefore also evaluated sociability in the three chamber test in the current study.
Experimental Procedures
Subjects
All procedures were approved by the Institutional Animal Care and Use Committees (IACUC) of the University of California Davis, and followed the NIH Guide for the Care and Use of Laboratory Animals. The Shank3B line characterized by a mutation within the PDZ domain was originally generated by the Feng lab ( Peca et al., 2011). A neo cassette replaced exons 13–16 of the Shank3 gene, resulting in a deficiency of isoforms Shank3α and Shank3β, and a reduction in expression of the Shank3γ isoform. Breeding pairs were purchased from The Jackson Laboratory (Bar Harbor, Maine, stock #01768). Genotype was determined by standard PCR, with the following primers: primer F1b (GAGCTCTACTCCCTTAGGACTT) and R1b (TCCCCCTTTCACTGGACACCC) for the wild-type allele (316 base pairs), and F1b and R2 (TCAGGGT-TATTGTCTCATGAGC; in the neo cassette) for the mutant allele (360 base pairs). The neo cassette was not removed. Heterozygous (+/–) males and females were bred to generate subject mice used in the present study. Juveniles were weaned between 21 and 24 days of age and housed by sex in cages of 2–4 littermates per cage. Group-housed male subjects were tested between 3 and 5 months of age. Cohort 1 was used for the touchscreen experiment, Cohort 2 for the open field assay, and Cohort 3 for the social approach assay and repetitive self-grooming. Standard rodent chow and tap water were available ad libitum prior to the start of the touchscreen experiment. In addition to standard bedding, a Nestlet square and a cardboard tube (Jonesville Paper Tube Corp., Michigan) were provided in each cage. The colony room was maintained on a 12:12 light/dark cycle with lights on at 7:00 AM, and at approximately 20 °C and 55% humidity. Behavioral testing was conducted between 9:00 AM and 5:00 PM.
Touchscreen pairwise discrimination
Pairwise visual discrimination was tested in the automated Bussey-Saksida touchscreen apparatus for mice (Campden Instruments Ltd/Lafayette Instruments, Lafayette, IL, USA), using a procedure modified based on original methods described previously ( Bussey et al., 2000; Brigman and Rothblat, 2008; Bussey et al., 2012; Brigman et al., 2013; DePoy et al., 2013; Oomen et al., 2013; Silverman et al., 2015b). The reinforcer was 20 μl of a palatable liquid nutritional supplement (Strawberry Ensure Plus, Abbott, IL, USA) diluted to 50% with water. Each session was conducted under overhead lighting (∼60 lux). A standard tone cue was used to signal the delivery of the reinforcer during pre-training and acquisition. Prior to pre-training, subject mice were weighed, and placed on a restricted diet of 2–4 g of rodent chow per mouse per day, to induce a 15% weight loss. Body weight was carefully monitored throughout the experiment, to ensure that a minimum of 85% of free feeding body weight was maintained for each mouse.
An efficient pre-training regimen was validated with pilot animals (personal communication with Dr. Stacey Rizzo, Jackson Laboratory) and utilized based on previously published work ( McTighe et al., 2013). The pre-training consisted of four stages. Stage 1 consisted of two days of habituation (20 min on day 1, and 40 min on day 2) to the chamber and the liquid diet with no images on the screen under overhead lighting (∼60 lux). Stage 2 was a single 45-min session in which entering and exiting the food magazine initiates the next trial and triggers additional reward under overhead lighting. During Stage 3, subjects were trained in daily 45-min sessions during which an image (a random picture from a selection of 40 images) was presented in one of the two windows, and remained on the screen until it was touched. Mice must complete 30 trials/day for two consecutive days in order to advance to the next stage. In Stage 4, subjects were trained in 45-min daily sessions in which touching the blank side of the screen was discouraged with a 5-s time-out during which the overhead lighting turned off. Completion of at least 30 trials, at an average accuracy of 80%, on two consecutive days, is required for advancement. Images used in Stages 3 and 4 were not used in the subsequent discrimination task. Only mice that completed all stages of pre-training were advanced to the pairwise visual discrimination task. Subjects were trained to discriminate between two novel images, a spider and an airplane, presented in a spatially pseudo-randomized manner in the two windows of the touchscreen. Each 45-min session consisted of unlimited number of trials separated by 15-s inter-trial intervals (ITI). Designation of the correct and incorrect images was counterbalanced across mice within each genotype. Correct responses were rewarded. Each incorrect response was followed by a correction trial in which the images were presented in an identical manner to the previous trial, until a correct response was made. Criterion was completing at least 30 trials, at an accuracy of 80% or higher, on two consecutive days. Days to reach criterion, percentage of mice reaching criterion on each day, number of errors, correction errors, and total trials were compared between genotypes. Our more time-consuming, five-stage pre-training procedure was described previously ( Silverman et al., 2015a, b; Yang et al., 2015).
Open field activity
Open field exploratory activity was evaluated as previously described ( Yang et al., 2009; Silverman et al., 2010a– c; Yang et al., 2012; Silverman et al., 2015a, b). Briefly, each animal was tested in a VersaMax Animal Activity Monitoring System (Accuscan, Columbus, OH, USA) for a 30-min session. Total distance traversed, horizontal activity, vertical activity, and time spent in the center were automatically measured.
Automated three-chambered social approach task
Social approach was assayed using methods modified based from our previous studies ( Yang et al., 2009; Silverman et al., 2010a– c; Silverman et al., 2011; Yang et al., 2011, 2012; Silverman et al., 2015a, b). The current methods were recently described in ( Silverman et al., 2015a, b). Each rectangular three-chambered apparatus (40 cm × 60 cm × 23 cm) was made of non-reflective matte white finished acrylic (P95 White, Tap Plastics, Sacramento, CA, USA). Opaque retractable doors (12 cm × 33 cm with 5 cm × 10 cm doorways) separated the compartments and allowed entries across chambers. Time spent in each chamber was detected using the EthoVision XT videotracking software (Version 9.0, Nol-dus Information Technologies, Leesburg, VA, USA). Sniffing was defined as head facing the cup enclosure (inverted wire cup, Galaxy Cup, Kitchen Plus, http://www.kitchen-plus.com) with the nose point within 2 cm from the enclosure. Two infrared sensitive cameras (Ike-gami ICD-49, B&H Photo, New York, NY, USA) mounted directly above four three-chambered units recorded the test sessions. Infrared lighting (Nightvisionexperts.com) provided uniform dim illumination. Time spent in each chamber and time spent sniffing each cup were automatically measured using the Ethovision software (Noldus Information Tech Inc., Leesburg, VA, USA).
Repetitive self-grooming
The self-grooming test was conducted in empty clean mouse cages. Each animal was habituated to the cage (with the plastic lid on and the food hopper off) for 10 min and recorded for self-grooming behavior for the following 10 min. Recorded videos were scored by two investigators blinded of genotype information. Interrater reliability was >95%.
Statistical analysis
Touchscreen parameters (days to reach criterion, trials to criterion, errors to criterion, and correction errors to criterion) were analyzed with paired t-test. Log-rank Mantel-Cox test was used to analyze the percentage of animals that reached criteria in the survival/completion analysis for the touchscreen test. Open field parameters (total distance traveled, horizontal activity, vertical activity, and center time) were analyzed with Repeated Measures ANOVA, with genotype as the between-group factor and time as the within-group factor. Repeated Measures ANOVA (∼ paired t-test) was used to analyze social approach data. Comparisons between time spent in the chamber with the novel mouse and time spent in the chamber with the novel object were compared within each genotype. Similarly, time sniffing the novel stimulus mouse versus time sniffing the novel object were compared within each genotype, as previously described ( Silverman et al., 2010; Yang et al., 2011; Silverman et al., 2015a, b). Self-grooming data were analyzed using paired t-test.
Results
Poor performance of −/− during pre-training stages
Eight null mutants (−/−) were initially included in the study. Genotype differences were not statistically significant for numbers of trials completed on habituation day 1 ( F 2,26 = 1.40, NS) or habituation day 2 ( F 2,26 = 1.82, NS), although trends were observed for −/− to complete fewer trials than +/+ on both days. As shown in Table 1, significant genotype effects were found in a number of trials completed in Stage 2 ( F 2,26 = 3.63, p < .05) and days to reach criterion in Stage 3 ( F 2,26 = p < 5.29, p < .05). Tukey’s post hoc analysis indicated that −/− completed significantly fewer trials in Stage 2 and required more days to reach criterion in Stage 3, as compared to +/+ ( p < .05 for each comparison).
Table 1.
Pre-training performance in Shank3B mice. Shank3 homozygous mutants (−/−) exhibited trends toward completing fewer trials in Stage 1, completed significantly fewer trials in Stage 2, and required significantly more days to reach criterion in Stage 3.
| Pre-training stage | +/+ ( N = 7) | +/– ( N = 14) | −/− ( N = 8) | ANOVA p value |
|---|---|---|---|---|
| Stage 1: Habituation Day 1 # of trials | 15.9 ± 3.8 | 15.2 ± 2.9 | 8.8 ± 1.7 | 0.26 |
| Stage 1: Habituation Day 2 # of trials | 78.6 ± 11.2 | 74.2 ± 14.1 | 41.1 ± 14.1 | 0.08 |
| Stage 2: # of trials | 38.1 ± 10.6 | 25.4 ± 3.8 | 13.1 ± 4.4 * | 0.04 |
| Stage 3: Days to reach criterion | 2.4 ± 0.4 | 4.0 ± 0.76 | 6.63 ± 1.0 * | 0.01 |
*
p < .05 or less vs. +/+
Touchscreen pairwise discrimination deficits
As illustrated in Fig. 1, +/– mice required significantly more training days to learn to discriminate two images displayed on the touchscreen ( Fig. 1A, t = 2.36, p < .05). Analysis of survival curves, i.e. percentage of mice that reached the 80% accuracy criterion on each training day indicated that the percentage of mice that reached criterion was significantly lower in +/– than in +/+ ( Fig. 1B, Log-rank Mantel-Cox test, χ 2 = 19.39, p < .001).
Fig. 1.
Touchscreen pairwise discrimination deficits in Shank3B mice. (A) +/– took significantly more training days to reach the criterion of 80% correct responses on the pairwise visual discrimination during the initial acquisition. (B) The percentage of mice that reached criterion across the training days was significantly lower in +/– than in +/+. (C–E) During discrimination training, +/– exhibited trends toward making more trials to reach criterion, more correction errors, and more errors. (F) No genotype differences were found in trials per session. Data are presented as mean ± standard error of the mean in all figures (except (B)). * p < .05 vs. +/+.
Analysis of additional parameters indicated that +/– mice exhibited a trend toward requiring more trials to reach criterion, compared to +/+ controls ( Fig. 1C, t = 1.87, p = 0.078), suggesting slower learning. Trends were also detected for +/– to make more errors (first trial error) ( Fig. 1E, t = 1.93, p = .069) and more correction errors ( Fig. 1D, t = 1.86, p = 0.085) compared to +/+. Importantly, the two genotypes did not differ in average trials per session ( Fig. 1F, t = 1.62, p = 0.12), indicating that both genotypes were actively engaged in the learning task. These data corroboratively indicated a deficit in visual discrimination learning in +/–.
Pre-training performance could reveal motor or motivational deficits, as well as general deficits in acquiring touchscreen tasks. During pre-training stages, we analyzed trials/session across three genotypes for Stages 1 and 2, and between +/+ and +/– for Stages 3 and 4. As shown in Table 1, trials/session did not differ between +/+ and +/– in Stages 1 and 2. No significant genotype differences were found in trials/ session in Stage 3 ( t = −1.267, NS) or Stage 4 ( t = 1.747, p = 0.097). In Stages 3 and 4, the animals either touch the window with an image in it, or touch the blank window. We termed the response “image touch” and “blank touch”. In Stage 3 (in which the animals were trained to touch the window with an image instead of the blank window), no genotype differences were found in days to reach criterion ( Fig. 2A, t = −2.7, NS), total trials to criterion ( Fig. 2B, t = −1.27, NS), and % blank touches expressed as blank touches/total touches × 100 ( Fig. 2C, t = 1.45, NS). In Stage 4 (in which the animals were given a brief timeout for each incorrect response), no significant genotype differences were found for days to reach criterion ( Fig. 2D, t = −0.14, NS), total trials to criterion ( Fig. 2E, t = 1.747, NS), and % blank touches ( Fig. 2F, t = 1.196, NS), suggesting that +/– did not have deficits in acquiring or participating in the touchscreen assay. −/− were not advanced to pairwise visual discrimination, due to their poor performance in pre-training. To detect genotype differences in task-participation at different pre-training stages, we analyzed trials/session across three genotypes for Stages 1 and 2, and between +/+ and +/– for Stages 3 and 4. As shown in Table 1, trials/session did not differ between +/+ and +/– in Stages 1 and 2. No significant genotype differences were found in trials/session in Stage 3 ( t = −1.27, NS) or Stage 4 ( t = 1.75, p = 0.097). No genotype differences were found in blank touches/session in Stage 3 ( t = −0.30, NS) or Stage 4 ( t = 1.19, NS). Data not shown.
Fig. 2.
Normal pre-training performance in Shank3B +/– mice. Pre-training performance could reveal motor or motivational deficits in +/–. (A, D) +/+ and +/– did not differ in days to reach criterion in Stages 3 or 4. (B, E) Trials to reach criterion was not different between genotypes in Stages 3 or 4. (C, F) % blank touches did not differ between +/+ and +/– in Stages 3 or 4.
Open field
Fig. 3 illustrates normal open field activity in +/– and reduced activity in –/–. Significant genotype differences were found in total distance traveled ( F 2,41 = 3.35, p < .05), horizontal activity ( F 2,41 = 4.5, p < .01), vertical activity ( F 2,41 = 7.8, p < .01), and center time ( F 2,41 = 5.5, p < .01). Post-hoc analysis revealed that −/− were significantly reduced on all four parameters ( p < .01 for each comparison).
Fig. 3.
Normal open field activity in Shank3B +/– mice. (A–D) Significant genotype differences were found on total distance traveled, horizontal activity, vertical activity, and center time. Post hoc analysis revealed that −/− were significantly reduced on all four parameters. We excluded −/− from the touchscreen experiment, because of their low locomotor activity could greatly confound touchscreen performance.
Social approach in the three-chambered apparatus
As Fig. 4 illustrates, normal sociability in the three-chambered task was detected in both +/+ and +/– genotypes. Both genotypes spent more time in the chamber with the novel stimulus mouse than in the chamber with the novel object (+/+: F 1,13 = 14.7, p < .01; +/–: F 1,13 = 6.3, p < .05). Similarly, both genotypes spent more time sniffing the novel mouse than the novel object (+/+: F 1,13 = 4.3, p < .05; +/–: F 1,13 = 10.0, p < .01). Number of transitions across chambers was not different between genotypes during the 10-min habituation phase ( Fig 4D, F 1,26 = 0.54, NS) or in the sociability phase ( Fig 4C, F 1,26 = 1.62, NS), ruling out hypo- or hyperactivity as influencing factors and providing corroborating measures to the open field data.
Fig. 4.
Normal social approach in Shank3B +/– mice. (A) Both genotypes spent more time in the chamber with the novel stimulus mouse than in the chamber with the novel object. (B) Both genotypes spent more time sniffing the novel mouse than the novel object. (C, D) Number of transitions across chambers was not different between genotypes during the 10-min habituation phase or in the sociability phase. * p < .05 novel mouse vs. novel object.
Repetitive self-grooming
As shown in Fig. 5, a trend was observed for +/– to exhibit increased self-grooming as compared to +/+ ( t = 1.80, .05 < p < .10, NS). No skin lesions were observed in +/–.
Fig. 5.
Modestly increased self-grooming in Shank3B +/– mice. +/– mice exhibited modestly increased self-grooming. No skin lesions were observed in +/–.
Discussion
Mouse models are indispensable tools for studying neurobiological mechanisms behind cognitive impairments caused by genetic abnormalities. Cognitive functions have been studied in a number of Shank3 deletion models, using simple assays ( Bozdagi et al., 2010; Peca et al., 2011; Wang et al., 2011; Kouser et al., 2013). One line of mice homozygous for the exon 4–9 (coding for ankryin domain) deletion exhibited impaired novel object recognition but normal fear conditioning and spatial learning ( Yang et al., 2012). Null mutants of a second line of the exon 4–9 deletion exhibited impaired reversal learning in the Morris water maze test ( Kouser et al., 2013). Mice homozygous for the exon 13–16 (coding for the PDZ domain) deletion exhibited normal spatial learning ( Peca et al., 2011). Mice homozygous for exon 21 (coding for the Homer binding domain) deletion exhibited impaired reversal learning in the Morris water maze ( Kouser et al., 2013). +/– mice of the exon 21 model exhibited impaired eye-blink conditioning, a cerebellar-dependent learning task ( Kloth et al., 2015). The present study evaluated complex cognitive function in the Shank3B model using a touchscreen pairwise visual discrimination task – a computerized cognitive task with high translational value and a potential to reveal preclinical phenotypes that are directly relevant to clinical research. Results indicated that +/– Shank3B mice exhibited impaired pairwise visual discrimination learning in t
(Truncated: full text at source URL.)